ID: 1189194477

View in Genome Browser
Species Human (GRCh38)
Location X:39141070-39141092
Sequence GGACTCAGGAAGCTCCATCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189194473_1189194477 2 Left 1189194473 X:39141045-39141067 CCAGGGCTCTTATAGGTCCTCAT No data
Right 1189194477 X:39141070-39141092 GGACTCAGGAAGCTCCATCTAGG No data
1189194469_1189194477 22 Left 1189194469 X:39141025-39141047 CCAACGAGGTAAAATAGGGACCA No data
Right 1189194477 X:39141070-39141092 GGACTCAGGAAGCTCCATCTAGG No data
1189194468_1189194477 23 Left 1189194468 X:39141024-39141046 CCCAACGAGGTAAAATAGGGACC No data
Right 1189194477 X:39141070-39141092 GGACTCAGGAAGCTCCATCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189194477 Original CRISPR GGACTCAGGAAGCTCCATCT AGG Intergenic
No off target data available for this crispr