ID: 1189195435

View in Genome Browser
Species Human (GRCh38)
Location X:39148406-39148428
Sequence CGCTGGCTTGTCTGAAGTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189195435_1189195439 15 Left 1189195435 X:39148406-39148428 CCAGGACTTCAGACAAGCCAGCG No data
Right 1189195439 X:39148444-39148466 CCTGCATAAAGACGATATTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189195435 Original CRISPR CGCTGGCTTGTCTGAAGTCC TGG (reversed) Intergenic
No off target data available for this crispr