ID: 1189195540

View in Genome Browser
Species Human (GRCh38)
Location X:39149121-39149143
Sequence TCACCTCCATGGTGATCTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189195540_1189195543 6 Left 1189195540 X:39149121-39149143 CCTTCAGATCACCATGGAGGTGA No data
Right 1189195543 X:39149150-39149172 TCTCAGCAAATTCATGCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189195540 Original CRISPR TCACCTCCATGGTGATCTGA AGG (reversed) Intergenic