ID: 1189195540 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | X:39149121-39149143 |
| Sequence | TCACCTCCATGGTGATCTGA AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1189195540_1189195543 | 6 | Left | 1189195540 | X:39149121-39149143 | CCTTCAGATCACCATGGAGGTGA | No data | ||
| Right | 1189195543 | X:39149150-39149172 | TCTCAGCAAATTCATGCTGCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1189195540 | Original CRISPR | TCACCTCCATGGTGATCTGA AGG (reversed) | Intergenic | ||