ID: 1189196727

View in Genome Browser
Species Human (GRCh38)
Location X:39159863-39159885
Sequence ATGTGGAGATGAGCTTTGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189196727_1189196731 21 Left 1189196727 X:39159863-39159885 CCCCTCAAAGCTCATCTCCACAT No data
Right 1189196731 X:39159907-39159929 AATATTTACTGCACTCCTGCTGG No data
1189196727_1189196732 29 Left 1189196727 X:39159863-39159885 CCCCTCAAAGCTCATCTCCACAT No data
Right 1189196732 X:39159915-39159937 CTGCACTCCTGCTGGATGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189196727 Original CRISPR ATGTGGAGATGAGCTTTGAG GGG (reversed) Intergenic
No off target data available for this crispr