ID: 1189198991

View in Genome Browser
Species Human (GRCh38)
Location X:39175595-39175617
Sequence CAGTGGGGAAGGAGAGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189198977_1189198991 18 Left 1189198977 X:39175554-39175576 CCTACAGCTGCTCCTGGTTGGCC No data
Right 1189198991 X:39175595-39175617 CAGTGGGGAAGGAGAGAGGAGGG No data
1189198973_1189198991 29 Left 1189198973 X:39175543-39175565 CCTGGTGAGGCCCTACAGCTGCT No data
Right 1189198991 X:39175595-39175617 CAGTGGGGAAGGAGAGAGGAGGG No data
1189198976_1189198991 19 Left 1189198976 X:39175553-39175575 CCCTACAGCTGCTCCTGGTTGGC No data
Right 1189198991 X:39175595-39175617 CAGTGGGGAAGGAGAGAGGAGGG No data
1189198980_1189198991 6 Left 1189198980 X:39175566-39175588 CCTGGTTGGCCAATAACGGGCCC No data
Right 1189198991 X:39175595-39175617 CAGTGGGGAAGGAGAGAGGAGGG No data
1189198982_1189198991 -3 Left 1189198982 X:39175575-39175597 CCAATAACGGGCCCAGAAGGCAG No data
Right 1189198991 X:39175595-39175617 CAGTGGGGAAGGAGAGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189198991 Original CRISPR CAGTGGGGAAGGAGAGAGGA GGG Intergenic
No off target data available for this crispr