ID: 1189201226

View in Genome Browser
Species Human (GRCh38)
Location X:39197253-39197275
Sequence CCTTCATGGCAGAGGCTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189201219_1189201226 4 Left 1189201219 X:39197226-39197248 CCTGATCCAAGCTTCCTCATGGT No data
Right 1189201226 X:39197253-39197275 CCTTCATGGCAGAGGCTGGATGG No data
1189201220_1189201226 -2 Left 1189201220 X:39197232-39197254 CCAAGCTTCCTCATGGTTTAGCC No data
Right 1189201226 X:39197253-39197275 CCTTCATGGCAGAGGCTGGATGG No data
1189201222_1189201226 -10 Left 1189201222 X:39197240-39197262 CCTCATGGTTTAGCCTTCATGGC No data
Right 1189201226 X:39197253-39197275 CCTTCATGGCAGAGGCTGGATGG No data
1189201217_1189201226 20 Left 1189201217 X:39197210-39197232 CCATATATACTGTCTTCCTGATC No data
Right 1189201226 X:39197253-39197275 CCTTCATGGCAGAGGCTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189201226 Original CRISPR CCTTCATGGCAGAGGCTGGA TGG Intergenic
No off target data available for this crispr