ID: 1189204930

View in Genome Browser
Species Human (GRCh38)
Location X:39229728-39229750
Sequence CTCCAGGGTGGCAAAGGTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189204930_1189204940 6 Left 1189204930 X:39229728-39229750 CCTGGACCTTTGCCACCCTGGAG No data
Right 1189204940 X:39229757-39229779 CATTTTAATGGAGGAAGTTTGGG No data
1189204930_1189204938 -3 Left 1189204930 X:39229728-39229750 CCTGGACCTTTGCCACCCTGGAG No data
Right 1189204938 X:39229748-39229770 GAGTGGTGGCATTTTAATGGAGG No data
1189204930_1189204939 5 Left 1189204930 X:39229728-39229750 CCTGGACCTTTGCCACCCTGGAG No data
Right 1189204939 X:39229756-39229778 GCATTTTAATGGAGGAAGTTTGG No data
1189204930_1189204937 -6 Left 1189204930 X:39229728-39229750 CCTGGACCTTTGCCACCCTGGAG No data
Right 1189204937 X:39229745-39229767 CTGGAGTGGTGGCATTTTAATGG No data
1189204930_1189204941 7 Left 1189204930 X:39229728-39229750 CCTGGACCTTTGCCACCCTGGAG No data
Right 1189204941 X:39229758-39229780 ATTTTAATGGAGGAAGTTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189204930 Original CRISPR CTCCAGGGTGGCAAAGGTCC AGG (reversed) Intergenic
No off target data available for this crispr