ID: 1189208271

View in Genome Browser
Species Human (GRCh38)
Location X:39260668-39260690
Sequence AGGTGTAAGGGGAAGGGGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189208271_1189208282 28 Left 1189208271 X:39260668-39260690 CCATGCCCCTTCCCCTTACACCT No data
Right 1189208282 X:39260719-39260741 TTGTCACCCCTCTGTAGAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189208271 Original CRISPR AGGTGTAAGGGGAAGGGGCA TGG (reversed) Intergenic
No off target data available for this crispr