ID: 1189208899

View in Genome Browser
Species Human (GRCh38)
Location X:39266118-39266140
Sequence TTTACTCATGTCTCCTATTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189208899_1189208902 -3 Left 1189208899 X:39266118-39266140 CCATAATAGGAGACATGAGTAAA No data
Right 1189208902 X:39266138-39266160 AAAGGAGAGAATGATAGGCTTGG No data
1189208899_1189208905 27 Left 1189208899 X:39266118-39266140 CCATAATAGGAGACATGAGTAAA No data
Right 1189208905 X:39266168-39266190 AAAAAAGGTCTTCTTTCCCCAGG No data
1189208899_1189208903 12 Left 1189208899 X:39266118-39266140 CCATAATAGGAGACATGAGTAAA No data
Right 1189208903 X:39266153-39266175 AGGCTTGGTGAAGCCAAAAAAGG No data
1189208899_1189208901 -8 Left 1189208899 X:39266118-39266140 CCATAATAGGAGACATGAGTAAA No data
Right 1189208901 X:39266133-39266155 TGAGTAAAGGAGAGAATGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189208899 Original CRISPR TTTACTCATGTCTCCTATTA TGG (reversed) Intergenic
No off target data available for this crispr