ID: 1189211408

View in Genome Browser
Species Human (GRCh38)
Location X:39287093-39287115
Sequence AAAAATGCACACATGTAACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189211408_1189211413 21 Left 1189211408 X:39287093-39287115 CCAAGTTACATGTGTGCATTTTT No data
Right 1189211413 X:39287137-39287159 CCTGCCTTTATCTTATTCAAAGG No data
1189211408_1189211410 -9 Left 1189211408 X:39287093-39287115 CCAAGTTACATGTGTGCATTTTT No data
Right 1189211410 X:39287107-39287129 TGCATTTTTACAAGAGCTATGGG No data
1189211408_1189211409 -10 Left 1189211408 X:39287093-39287115 CCAAGTTACATGTGTGCATTTTT No data
Right 1189211409 X:39287106-39287128 GTGCATTTTTACAAGAGCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189211408 Original CRISPR AAAAATGCACACATGTAACT TGG (reversed) Intergenic
No off target data available for this crispr