ID: 1189214259

View in Genome Browser
Species Human (GRCh38)
Location X:39309838-39309860
Sequence CAGGAAATGAAGGGGCCTGT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189214255_1189214259 -6 Left 1189214255 X:39309821-39309843 CCATTAGATATTGAAAACAGGAA No data
Right 1189214259 X:39309838-39309860 CAGGAAATGAAGGGGCCTGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189214259 Original CRISPR CAGGAAATGAAGGGGCCTGT CGG Intergenic
No off target data available for this crispr