ID: 1189215384

View in Genome Browser
Species Human (GRCh38)
Location X:39318717-39318739
Sequence AAGCTGAGCCCAGACTAGAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189215381_1189215384 27 Left 1189215381 X:39318667-39318689 CCAGTCCTGTGATATGAAGCAGA No data
Right 1189215384 X:39318717-39318739 AAGCTGAGCCCAGACTAGATTGG No data
1189215380_1189215384 28 Left 1189215380 X:39318666-39318688 CCCAGTCCTGTGATATGAAGCAG No data
Right 1189215384 X:39318717-39318739 AAGCTGAGCCCAGACTAGATTGG No data
1189215382_1189215384 22 Left 1189215382 X:39318672-39318694 CCTGTGATATGAAGCAGAACCAC No data
Right 1189215384 X:39318717-39318739 AAGCTGAGCCCAGACTAGATTGG No data
1189215383_1189215384 3 Left 1189215383 X:39318691-39318713 CCACTACAGTCTGAAGCATTGCT No data
Right 1189215384 X:39318717-39318739 AAGCTGAGCCCAGACTAGATTGG No data
1189215379_1189215384 29 Left 1189215379 X:39318665-39318687 CCCCAGTCCTGTGATATGAAGCA No data
Right 1189215384 X:39318717-39318739 AAGCTGAGCCCAGACTAGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189215384 Original CRISPR AAGCTGAGCCCAGACTAGAT TGG Intergenic
No off target data available for this crispr