ID: 1189221681

View in Genome Browser
Species Human (GRCh38)
Location X:39377610-39377632
Sequence GATTCCTAAAAAAGAACCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189221681_1189221685 -6 Left 1189221681 X:39377610-39377632 CCCTGGGTTCTTTTTTAGGAATC No data
Right 1189221685 X:39377627-39377649 GGAATCCCTGGGCAGTGTTCTGG No data
1189221681_1189221688 10 Left 1189221681 X:39377610-39377632 CCCTGGGTTCTTTTTTAGGAATC No data
Right 1189221688 X:39377643-39377665 GTTCTGGAATTGATCTATACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189221681 Original CRISPR GATTCCTAAAAAAGAACCCA GGG (reversed) Intergenic
No off target data available for this crispr