ID: 1189222698

View in Genome Browser
Species Human (GRCh38)
Location X:39385891-39385913
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189222698_1189222713 21 Left 1189222698 X:39385891-39385913 CCTCATCCACCCTTCATCCTCAT No data
Right 1189222713 X:39385935-39385957 ACTCCTGGAGTGCAGGGTTGGGG No data
1189222698_1189222706 14 Left 1189222698 X:39385891-39385913 CCTCATCCACCCTTCATCCTCAT No data
Right 1189222706 X:39385928-39385950 TGACCCCACTCCTGGAGTGCAGG No data
1189222698_1189222703 -10 Left 1189222698 X:39385891-39385913 CCTCATCCACCCTTCATCCTCAT No data
Right 1189222703 X:39385904-39385926 TCATCCTCATGATTCTGGTGAGG No data
1189222698_1189222705 6 Left 1189222698 X:39385891-39385913 CCTCATCCACCCTTCATCCTCAT No data
Right 1189222705 X:39385920-39385942 GGTGAGGATGACCCCACTCCTGG No data
1189222698_1189222711 19 Left 1189222698 X:39385891-39385913 CCTCATCCACCCTTCATCCTCAT No data
Right 1189222711 X:39385933-39385955 CCACTCCTGGAGTGCAGGGTTGG No data
1189222698_1189222707 15 Left 1189222698 X:39385891-39385913 CCTCATCCACCCTTCATCCTCAT No data
Right 1189222707 X:39385929-39385951 GACCCCACTCCTGGAGTGCAGGG No data
1189222698_1189222712 20 Left 1189222698 X:39385891-39385913 CCTCATCCACCCTTCATCCTCAT No data
Right 1189222712 X:39385934-39385956 CACTCCTGGAGTGCAGGGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189222698 Original CRISPR ATGAGGATGAAGGGTGGATG AGG (reversed) Intergenic