ID: 1189222701

View in Genome Browser
Species Human (GRCh38)
Location X:39385900-39385922
Sequence ACCAGAATCATGAGGATGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189222701_1189222705 -3 Left 1189222701 X:39385900-39385922 CCCTTCATCCTCATGATTCTGGT No data
Right 1189222705 X:39385920-39385942 GGTGAGGATGACCCCACTCCTGG No data
1189222701_1189222707 6 Left 1189222701 X:39385900-39385922 CCCTTCATCCTCATGATTCTGGT No data
Right 1189222707 X:39385929-39385951 GACCCCACTCCTGGAGTGCAGGG No data
1189222701_1189222712 11 Left 1189222701 X:39385900-39385922 CCCTTCATCCTCATGATTCTGGT No data
Right 1189222712 X:39385934-39385956 CACTCCTGGAGTGCAGGGTTGGG No data
1189222701_1189222713 12 Left 1189222701 X:39385900-39385922 CCCTTCATCCTCATGATTCTGGT No data
Right 1189222713 X:39385935-39385957 ACTCCTGGAGTGCAGGGTTGGGG No data
1189222701_1189222706 5 Left 1189222701 X:39385900-39385922 CCCTTCATCCTCATGATTCTGGT No data
Right 1189222706 X:39385928-39385950 TGACCCCACTCCTGGAGTGCAGG No data
1189222701_1189222711 10 Left 1189222701 X:39385900-39385922 CCCTTCATCCTCATGATTCTGGT No data
Right 1189222711 X:39385933-39385955 CCACTCCTGGAGTGCAGGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189222701 Original CRISPR ACCAGAATCATGAGGATGAA GGG (reversed) Intergenic