ID: 1189222704

View in Genome Browser
Species Human (GRCh38)
Location X:39385908-39385930
Sequence TCATCCTCACCAGAATCATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189222704_1189222712 3 Left 1189222704 X:39385908-39385930 CCTCATGATTCTGGTGAGGATGA No data
Right 1189222712 X:39385934-39385956 CACTCCTGGAGTGCAGGGTTGGG No data
1189222704_1189222706 -3 Left 1189222704 X:39385908-39385930 CCTCATGATTCTGGTGAGGATGA No data
Right 1189222706 X:39385928-39385950 TGACCCCACTCCTGGAGTGCAGG No data
1189222704_1189222713 4 Left 1189222704 X:39385908-39385930 CCTCATGATTCTGGTGAGGATGA No data
Right 1189222713 X:39385935-39385957 ACTCCTGGAGTGCAGGGTTGGGG No data
1189222704_1189222711 2 Left 1189222704 X:39385908-39385930 CCTCATGATTCTGGTGAGGATGA No data
Right 1189222711 X:39385933-39385955 CCACTCCTGGAGTGCAGGGTTGG No data
1189222704_1189222707 -2 Left 1189222704 X:39385908-39385930 CCTCATGATTCTGGTGAGGATGA No data
Right 1189222707 X:39385929-39385951 GACCCCACTCCTGGAGTGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189222704 Original CRISPR TCATCCTCACCAGAATCATG AGG (reversed) Intergenic