ID: 1189222705

View in Genome Browser
Species Human (GRCh38)
Location X:39385920-39385942
Sequence GGTGAGGATGACCCCACTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189222699_1189222705 0 Left 1189222699 X:39385897-39385919 CCACCCTTCATCCTCATGATTCT No data
Right 1189222705 X:39385920-39385942 GGTGAGGATGACCCCACTCCTGG No data
1189222701_1189222705 -3 Left 1189222701 X:39385900-39385922 CCCTTCATCCTCATGATTCTGGT No data
Right 1189222705 X:39385920-39385942 GGTGAGGATGACCCCACTCCTGG No data
1189222702_1189222705 -4 Left 1189222702 X:39385901-39385923 CCTTCATCCTCATGATTCTGGTG No data
Right 1189222705 X:39385920-39385942 GGTGAGGATGACCCCACTCCTGG No data
1189222698_1189222705 6 Left 1189222698 X:39385891-39385913 CCTCATCCACCCTTCATCCTCAT No data
Right 1189222705 X:39385920-39385942 GGTGAGGATGACCCCACTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189222705 Original CRISPR GGTGAGGATGACCCCACTCC TGG Intergenic
No off target data available for this crispr