ID: 1189222713

View in Genome Browser
Species Human (GRCh38)
Location X:39385935-39385957
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189222701_1189222713 12 Left 1189222701 X:39385900-39385922 CCCTTCATCCTCATGATTCTGGT No data
Right 1189222713 X:39385935-39385957 ACTCCTGGAGTGCAGGGTTGGGG No data
1189222698_1189222713 21 Left 1189222698 X:39385891-39385913 CCTCATCCACCCTTCATCCTCAT No data
Right 1189222713 X:39385935-39385957 ACTCCTGGAGTGCAGGGTTGGGG No data
1189222699_1189222713 15 Left 1189222699 X:39385897-39385919 CCACCCTTCATCCTCATGATTCT No data
Right 1189222713 X:39385935-39385957 ACTCCTGGAGTGCAGGGTTGGGG No data
1189222702_1189222713 11 Left 1189222702 X:39385901-39385923 CCTTCATCCTCATGATTCTGGTG No data
Right 1189222713 X:39385935-39385957 ACTCCTGGAGTGCAGGGTTGGGG No data
1189222704_1189222713 4 Left 1189222704 X:39385908-39385930 CCTCATGATTCTGGTGAGGATGA No data
Right 1189222713 X:39385935-39385957 ACTCCTGGAGTGCAGGGTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189222713 Original CRISPR ACTCCTGGAGTGCAGGGTTG GGG Intergenic