ID: 1189222780

View in Genome Browser
Species Human (GRCh38)
Location X:39386579-39386601
Sequence TGGGAAAAGTATAAAGAGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189222780_1189222786 20 Left 1189222780 X:39386579-39386601 CCAACCTCTTTATACTTTTCCCA No data
Right 1189222786 X:39386622-39386644 GACAAGGGAAAGTTTGAGCAAGG No data
1189222780_1189222787 27 Left 1189222780 X:39386579-39386601 CCAACCTCTTTATACTTTTCCCA No data
Right 1189222787 X:39386629-39386651 GAAAGTTTGAGCAAGGCAAATGG No data
1189222780_1189222784 4 Left 1189222780 X:39386579-39386601 CCAACCTCTTTATACTTTTCCCA No data
Right 1189222784 X:39386606-39386628 CAGTCTGCAACATTAAGACAAGG No data
1189222780_1189222785 5 Left 1189222780 X:39386579-39386601 CCAACCTCTTTATACTTTTCCCA No data
Right 1189222785 X:39386607-39386629 AGTCTGCAACATTAAGACAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189222780 Original CRISPR TGGGAAAAGTATAAAGAGGT TGG (reversed) Intergenic
No off target data available for this crispr