ID: 1189223009

View in Genome Browser
Species Human (GRCh38)
Location X:39388838-39388860
Sequence TGGCAGGCCTATAATTATAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189223005_1189223009 1 Left 1189223005 X:39388814-39388836 CCTCTGTTTACACCTGCTGAATC No data
Right 1189223009 X:39388838-39388860 TGGCAGGCCTATAATTATAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189223009 Original CRISPR TGGCAGGCCTATAATTATAG TGG Intergenic
No off target data available for this crispr