ID: 1189230902

View in Genome Browser
Species Human (GRCh38)
Location X:39451539-39451561
Sequence CCATAGCAGCAGTGACTTAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189230902_1189230908 8 Left 1189230902 X:39451539-39451561 CCCTTAAGTCACTGCTGCTATGG No data
Right 1189230908 X:39451570-39451592 TTGAGAGCCACAACATACTTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189230902 Original CRISPR CCATAGCAGCAGTGACTTAA GGG (reversed) Intergenic
No off target data available for this crispr