ID: 1189230908

View in Genome Browser
Species Human (GRCh38)
Location X:39451570-39451592
Sequence TTGAGAGCCACAACATACTT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189230894_1189230908 29 Left 1189230894 X:39451518-39451540 CCACCACCTTCCCTCCCCTATCC No data
Right 1189230908 X:39451570-39451592 TTGAGAGCCACAACATACTTCGG No data
1189230896_1189230908 23 Left 1189230896 X:39451524-39451546 CCTTCCCTCCCCTATCCCTTAAG No data
Right 1189230908 X:39451570-39451592 TTGAGAGCCACAACATACTTCGG No data
1189230904_1189230908 7 Left 1189230904 X:39451540-39451562 CCTTAAGTCACTGCTGCTATGGC No data
Right 1189230908 X:39451570-39451592 TTGAGAGCCACAACATACTTCGG No data
1189230895_1189230908 26 Left 1189230895 X:39451521-39451543 CCACCTTCCCTCCCCTATCCCTT No data
Right 1189230908 X:39451570-39451592 TTGAGAGCCACAACATACTTCGG No data
1189230900_1189230908 14 Left 1189230900 X:39451533-39451555 CCCTATCCCTTAAGTCACTGCTG No data
Right 1189230908 X:39451570-39451592 TTGAGAGCCACAACATACTTCGG No data
1189230899_1189230908 15 Left 1189230899 X:39451532-39451554 CCCCTATCCCTTAAGTCACTGCT No data
Right 1189230908 X:39451570-39451592 TTGAGAGCCACAACATACTTCGG No data
1189230893_1189230908 30 Left 1189230893 X:39451517-39451539 CCCACCACCTTCCCTCCCCTATC No data
Right 1189230908 X:39451570-39451592 TTGAGAGCCACAACATACTTCGG No data
1189230901_1189230908 13 Left 1189230901 X:39451534-39451556 CCTATCCCTTAAGTCACTGCTGC No data
Right 1189230908 X:39451570-39451592 TTGAGAGCCACAACATACTTCGG No data
1189230898_1189230908 18 Left 1189230898 X:39451529-39451551 CCTCCCCTATCCCTTAAGTCACT No data
Right 1189230908 X:39451570-39451592 TTGAGAGCCACAACATACTTCGG No data
1189230902_1189230908 8 Left 1189230902 X:39451539-39451561 CCCTTAAGTCACTGCTGCTATGG No data
Right 1189230908 X:39451570-39451592 TTGAGAGCCACAACATACTTCGG No data
1189230897_1189230908 19 Left 1189230897 X:39451528-39451550 CCCTCCCCTATCCCTTAAGTCAC No data
Right 1189230908 X:39451570-39451592 TTGAGAGCCACAACATACTTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189230908 Original CRISPR TTGAGAGCCACAACATACTT CGG Intergenic
No off target data available for this crispr