ID: 1189232186

View in Genome Browser
Species Human (GRCh38)
Location X:39461159-39461181
Sequence CTCTCCCACCTCTGCAGGAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189232186_1189232195 25 Left 1189232186 X:39461159-39461181 CCTATCCTGCAGAGGTGGGAGAG No data
Right 1189232195 X:39461207-39461229 TCCAGGTACCCTACATCCCAGGG No data
1189232186_1189232194 24 Left 1189232186 X:39461159-39461181 CCTATCCTGCAGAGGTGGGAGAG No data
Right 1189232194 X:39461206-39461228 ATCCAGGTACCCTACATCCCAGG No data
1189232186_1189232189 8 Left 1189232186 X:39461159-39461181 CCTATCCTGCAGAGGTGGGAGAG No data
Right 1189232189 X:39461190-39461212 AGCCCATCATCCCAGAATCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189232186 Original CRISPR CTCTCCCACCTCTGCAGGAT AGG (reversed) Intergenic
No off target data available for this crispr