ID: 1189235423

View in Genome Browser
Species Human (GRCh38)
Location X:39483456-39483478
Sequence CAGCCAAGTCTAACCCAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189235422_1189235423 0 Left 1189235422 X:39483433-39483455 CCTGTTATTTCAGATGATTTTCA No data
Right 1189235423 X:39483456-39483478 CAGCCAAGTCTAACCCAGAGAGG No data
1189235419_1189235423 30 Left 1189235419 X:39483403-39483425 CCGAGAGAAAACTTTCTACCTTG No data
Right 1189235423 X:39483456-39483478 CAGCCAAGTCTAACCCAGAGAGG No data
1189235421_1189235423 1 Left 1189235421 X:39483432-39483454 CCCTGTTATTTCAGATGATTTTC No data
Right 1189235423 X:39483456-39483478 CAGCCAAGTCTAACCCAGAGAGG No data
1189235420_1189235423 12 Left 1189235420 X:39483421-39483443 CCTTGTTTAAACCCTGTTATTTC No data
Right 1189235423 X:39483456-39483478 CAGCCAAGTCTAACCCAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189235423 Original CRISPR CAGCCAAGTCTAACCCAGAG AGG Intergenic
No off target data available for this crispr