ID: 1189239524

View in Genome Browser
Species Human (GRCh38)
Location X:39515017-39515039
Sequence GGGGATGGGGAGCTGCGAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189239524_1189239535 15 Left 1189239524 X:39515017-39515039 CCCACTCGCAGCTCCCCATCCCC No data
Right 1189239535 X:39515055-39515077 CTCTCCCTCAGCTGCAACCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189239524 Original CRISPR GGGGATGGGGAGCTGCGAGT GGG (reversed) Intergenic
No off target data available for this crispr