ID: 1189245368

View in Genome Browser
Species Human (GRCh38)
Location X:39559225-39559247
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189245365_1189245368 23 Left 1189245365 X:39559179-39559201 CCATGAAGGCGAGTGGTTTTTAA No data
Right 1189245368 X:39559225-39559247 GTAACACTTAGAACCATGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189245368 Original CRISPR GTAACACTTAGAACCATGCC CGG Intergenic
No off target data available for this crispr