ID: 1189246904

View in Genome Browser
Species Human (GRCh38)
Location X:39570358-39570380
Sequence TCTCACACACTGATCTTAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189246904_1189246912 23 Left 1189246904 X:39570358-39570380 CCAGCTAAGATCAGTGTGTGAGA No data
Right 1189246912 X:39570404-39570426 TCCTCCAGATCTTTCCAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189246904 Original CRISPR TCTCACACACTGATCTTAGC TGG (reversed) Intergenic
No off target data available for this crispr