ID: 1189248529

View in Genome Browser
Species Human (GRCh38)
Location X:39581909-39581931
Sequence TGGGAATAACTTCCTGCCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189248529_1189248535 20 Left 1189248529 X:39581909-39581931 CCTCTGGCAGGAAGTTATTCCCA No data
Right 1189248535 X:39581952-39581974 TAGAGCTATAACCCACAACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189248529 Original CRISPR TGGGAATAACTTCCTGCCAG AGG (reversed) Intergenic
No off target data available for this crispr