ID: 1189248532

View in Genome Browser
Species Human (GRCh38)
Location X:39581928-39581950
Sequence TGAGGATTTGCACTTGCCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189248532_1189248535 1 Left 1189248532 X:39581928-39581950 CCCAGGGCAAGTGCAAATCCTCA No data
Right 1189248535 X:39581952-39581974 TAGAGCTATAACCCACAACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189248532 Original CRISPR TGAGGATTTGCACTTGCCCT GGG (reversed) Intergenic
No off target data available for this crispr