ID: 1189248535

View in Genome Browser
Species Human (GRCh38)
Location X:39581952-39581974
Sequence TAGAGCTATAACCCACAACT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189248528_1189248535 21 Left 1189248528 X:39581908-39581930 CCCTCTGGCAGGAAGTTATTCCC No data
Right 1189248535 X:39581952-39581974 TAGAGCTATAACCCACAACTTGG No data
1189248533_1189248535 0 Left 1189248533 X:39581929-39581951 CCAGGGCAAGTGCAAATCCTCAT No data
Right 1189248535 X:39581952-39581974 TAGAGCTATAACCCACAACTTGG No data
1189248532_1189248535 1 Left 1189248532 X:39581928-39581950 CCCAGGGCAAGTGCAAATCCTCA No data
Right 1189248535 X:39581952-39581974 TAGAGCTATAACCCACAACTTGG No data
1189248529_1189248535 20 Left 1189248529 X:39581909-39581931 CCTCTGGCAGGAAGTTATTCCCA No data
Right 1189248535 X:39581952-39581974 TAGAGCTATAACCCACAACTTGG No data
1189248527_1189248535 28 Left 1189248527 X:39581901-39581923 CCGAACTCCCTCTGGCAGGAAGT No data
Right 1189248535 X:39581952-39581974 TAGAGCTATAACCCACAACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189248535 Original CRISPR TAGAGCTATAACCCACAACT TGG Intergenic
No off target data available for this crispr