ID: 1189254041

View in Genome Browser
Species Human (GRCh38)
Location X:39623677-39623699
Sequence GATAGACATTCCCTTCCTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189254039_1189254041 4 Left 1189254039 X:39623650-39623672 CCAAAATACAATGGTGGACAGGC No data
Right 1189254041 X:39623677-39623699 GATAGACATTCCCTTCCTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189254041 Original CRISPR GATAGACATTCCCTTCCTAA AGG Intergenic
No off target data available for this crispr