ID: 1189254436

View in Genome Browser
Species Human (GRCh38)
Location X:39626987-39627009
Sequence GTAAACTCCCTGGCACTTCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189254436_1189254442 20 Left 1189254436 X:39626987-39627009 CCTAGAAGTGCCAGGGAGTTTAC No data
Right 1189254442 X:39627030-39627052 AAACAGTGAAAGCCACGGGTTGG No data
1189254436_1189254439 15 Left 1189254436 X:39626987-39627009 CCTAGAAGTGCCAGGGAGTTTAC No data
Right 1189254439 X:39627025-39627047 TCCACAAACAGTGAAAGCCACGG No data
1189254436_1189254441 16 Left 1189254436 X:39626987-39627009 CCTAGAAGTGCCAGGGAGTTTAC No data
Right 1189254441 X:39627026-39627048 CCACAAACAGTGAAAGCCACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189254436 Original CRISPR GTAAACTCCCTGGCACTTCT AGG (reversed) Intergenic
No off target data available for this crispr