ID: 1189254441

View in Genome Browser
Species Human (GRCh38)
Location X:39627026-39627048
Sequence CCACAAACAGTGAAAGCCAC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189254436_1189254441 16 Left 1189254436 X:39626987-39627009 CCTAGAAGTGCCAGGGAGTTTAC No data
Right 1189254441 X:39627026-39627048 CCACAAACAGTGAAAGCCACGGG No data
1189254437_1189254441 6 Left 1189254437 X:39626997-39627019 CCAGGGAGTTTACACTCTTCCAG No data
Right 1189254441 X:39627026-39627048 CCACAAACAGTGAAAGCCACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189254441 Original CRISPR CCACAAACAGTGAAAGCCAC GGG Intergenic
No off target data available for this crispr