ID: 1189255770

View in Genome Browser
Species Human (GRCh38)
Location X:39637802-39637824
Sequence GTCCATTTGTTCATTCCTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189255756_1189255770 19 Left 1189255756 X:39637760-39637782 CCTTAATCCTCTCCCCCCATCTA No data
Right 1189255770 X:39637802-39637824 GTCCATTTGTTCATTCCTGGGGG No data
1189255764_1189255770 3 Left 1189255764 X:39637776-39637798 CCATCTACTATAAGACATGGGAG No data
Right 1189255770 X:39637802-39637824 GTCCATTTGTTCATTCCTGGGGG No data
1189255761_1189255770 5 Left 1189255761 X:39637774-39637796 CCCCATCTACTATAAGACATGGG No data
Right 1189255770 X:39637802-39637824 GTCCATTTGTTCATTCCTGGGGG No data
1189255758_1189255770 7 Left 1189255758 X:39637772-39637794 CCCCCCATCTACTATAAGACATG No data
Right 1189255770 X:39637802-39637824 GTCCATTTGTTCATTCCTGGGGG No data
1189255759_1189255770 6 Left 1189255759 X:39637773-39637795 CCCCCATCTACTATAAGACATGG No data
Right 1189255770 X:39637802-39637824 GTCCATTTGTTCATTCCTGGGGG No data
1189255755_1189255770 29 Left 1189255755 X:39637750-39637772 CCTCTTCATTCCTTAATCCTCTC No data
Right 1189255770 X:39637802-39637824 GTCCATTTGTTCATTCCTGGGGG No data
1189255757_1189255770 12 Left 1189255757 X:39637767-39637789 CCTCTCCCCCCATCTACTATAAG No data
Right 1189255770 X:39637802-39637824 GTCCATTTGTTCATTCCTGGGGG No data
1189255763_1189255770 4 Left 1189255763 X:39637775-39637797 CCCATCTACTATAAGACATGGGA No data
Right 1189255770 X:39637802-39637824 GTCCATTTGTTCATTCCTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189255770 Original CRISPR GTCCATTTGTTCATTCCTGG GGG Intergenic
No off target data available for this crispr