ID: 1189259106

View in Genome Browser
Species Human (GRCh38)
Location X:39665108-39665130
Sequence GGAATAAAAAGGCAGAGGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189259106_1189259112 -1 Left 1189259106 X:39665108-39665130 CCTTTCCTCTGCCTTTTTATTCC No data
Right 1189259112 X:39665130-39665152 CATCTGGGTCCCCAGCTGATTGG No data
1189259106_1189259117 21 Left 1189259106 X:39665108-39665130 CCTTTCCTCTGCCTTTTTATTCC No data
Right 1189259117 X:39665152-39665174 GATGGTGCCTGTCCATGTTGAGG No data
1189259106_1189259113 3 Left 1189259106 X:39665108-39665130 CCTTTCCTCTGCCTTTTTATTCC No data
Right 1189259113 X:39665134-39665156 TGGGTCCCCAGCTGATTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189259106 Original CRISPR GGAATAAAAAGGCAGAGGAA AGG (reversed) Intergenic