ID: 1189259110 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | X:39665119-39665141 |
Sequence | GGGACCCAGATGGAATAAAA AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 514 | |||
Summary | {0: 1, 1: 3, 2: 9, 3: 71, 4: 430} |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1189259110_1189259113 | -8 | Left | 1189259110 | X:39665119-39665141 | CCTTTTTATTCCATCTGGGTCCC | 0: 1 1: 3 2: 9 3: 71 4: 430 |
||
Right | 1189259113 | X:39665134-39665156 | TGGGTCCCCAGCTGATTGGATGG | No data | ||||
1189259110_1189259117 | 10 | Left | 1189259110 | X:39665119-39665141 | CCTTTTTATTCCATCTGGGTCCC | 0: 1 1: 3 2: 9 3: 71 4: 430 |
||
Right | 1189259117 | X:39665152-39665174 | GATGGTGCCTGTCCATGTTGAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1189259110 | Original CRISPR | GGGACCCAGATGGAATAAAA AGG (reversed) | Intergenic | ||