ID: 1189259110

View in Genome Browser
Species Human (GRCh38)
Location X:39665119-39665141
Sequence GGGACCCAGATGGAATAAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189259110_1189259113 -8 Left 1189259110 X:39665119-39665141 CCTTTTTATTCCATCTGGGTCCC No data
Right 1189259113 X:39665134-39665156 TGGGTCCCCAGCTGATTGGATGG No data
1189259110_1189259117 10 Left 1189259110 X:39665119-39665141 CCTTTTTATTCCATCTGGGTCCC No data
Right 1189259117 X:39665152-39665174 GATGGTGCCTGTCCATGTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189259110 Original CRISPR GGGACCCAGATGGAATAAAA AGG (reversed) Intergenic