ID: 1189259111

View in Genome Browser
Species Human (GRCh38)
Location X:39665129-39665151
Sequence CAATCAGCTGGGGACCCAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189259111_1189259117 0 Left 1189259111 X:39665129-39665151 CCATCTGGGTCCCCAGCTGATTG No data
Right 1189259117 X:39665152-39665174 GATGGTGCCTGTCCATGTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189259111 Original CRISPR CAATCAGCTGGGGACCCAGA TGG (reversed) Intergenic