ID: 1189259112

View in Genome Browser
Species Human (GRCh38)
Location X:39665130-39665152
Sequence CATCTGGGTCCCCAGCTGAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189259105_1189259112 24 Left 1189259105 X:39665083-39665105 CCAGGAGAGAGATGGGGCAAATT No data
Right 1189259112 X:39665130-39665152 CATCTGGGTCCCCAGCTGATTGG No data
1189259106_1189259112 -1 Left 1189259106 X:39665108-39665130 CCTTTCCTCTGCCTTTTTATTCC No data
Right 1189259112 X:39665130-39665152 CATCTGGGTCCCCAGCTGATTGG No data
1189259107_1189259112 -6 Left 1189259107 X:39665113-39665135 CCTCTGCCTTTTTATTCCATCTG No data
Right 1189259112 X:39665130-39665152 CATCTGGGTCCCCAGCTGATTGG No data
1189259103_1189259112 30 Left 1189259103 X:39665077-39665099 CCAATTCCAGGAGAGAGATGGGG No data
Right 1189259112 X:39665130-39665152 CATCTGGGTCCCCAGCTGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189259112 Original CRISPR CATCTGGGTCCCCAGCTGAT TGG Intergenic