ID: 1189259114 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | X:39665139-39665161 |
Sequence | AGGCACCATCCAATCAGCTG GGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 964 | |||
Summary | {0: 19, 1: 43, 2: 109, 3: 237, 4: 556} |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1189259114_1189259117 | -10 | Left | 1189259114 | X:39665139-39665161 | CCCCAGCTGATTGGATGGTGCCT | 0: 19 1: 43 2: 109 3: 237 4: 556 |
||
Right | 1189259117 | X:39665152-39665174 | GATGGTGCCTGTCCATGTTGAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1189259114 | Original CRISPR | AGGCACCATCCAATCAGCTG GGG (reversed) | Intergenic | ||