ID: 1189259114

View in Genome Browser
Species Human (GRCh38)
Location X:39665139-39665161
Sequence AGGCACCATCCAATCAGCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 964
Summary {0: 19, 1: 43, 2: 109, 3: 237, 4: 556}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189259114_1189259117 -10 Left 1189259114 X:39665139-39665161 CCCCAGCTGATTGGATGGTGCCT 0: 19
1: 43
2: 109
3: 237
4: 556
Right 1189259117 X:39665152-39665174 GATGGTGCCTGTCCATGTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189259114 Original CRISPR AGGCACCATCCAATCAGCTG GGG (reversed) Intergenic