ID: 1189259117

View in Genome Browser
Species Human (GRCh38)
Location X:39665152-39665174
Sequence GATGGTGCCTGTCCATGTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189259114_1189259117 -10 Left 1189259114 X:39665139-39665161 CCCCAGCTGATTGGATGGTGCCT No data
Right 1189259117 X:39665152-39665174 GATGGTGCCTGTCCATGTTGAGG No data
1189259107_1189259117 16 Left 1189259107 X:39665113-39665135 CCTCTGCCTTTTTATTCCATCTG No data
Right 1189259117 X:39665152-39665174 GATGGTGCCTGTCCATGTTGAGG No data
1189259110_1189259117 10 Left 1189259110 X:39665119-39665141 CCTTTTTATTCCATCTGGGTCCC No data
Right 1189259117 X:39665152-39665174 GATGGTGCCTGTCCATGTTGAGG No data
1189259111_1189259117 0 Left 1189259111 X:39665129-39665151 CCATCTGGGTCCCCAGCTGATTG No data
Right 1189259117 X:39665152-39665174 GATGGTGCCTGTCCATGTTGAGG No data
1189259106_1189259117 21 Left 1189259106 X:39665108-39665130 CCTTTCCTCTGCCTTTTTATTCC No data
Right 1189259117 X:39665152-39665174 GATGGTGCCTGTCCATGTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189259117 Original CRISPR GATGGTGCCTGTCCATGTTG AGG Intergenic