ID: 1189259250

View in Genome Browser
Species Human (GRCh38)
Location X:39666475-39666497
Sequence TATCTTACCAACAGTGGGTC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189259246_1189259250 8 Left 1189259246 X:39666444-39666466 CCATTACTTCTATGAGAAAATTC No data
Right 1189259250 X:39666475-39666497 TATCTTACCAACAGTGGGTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189259250 Original CRISPR TATCTTACCAACAGTGGGTC GGG Intergenic
No off target data available for this crispr