ID: 1189260946

View in Genome Browser
Species Human (GRCh38)
Location X:39678492-39678514
Sequence CAGTGGGGACATTTATCACC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189260940_1189260946 27 Left 1189260940 X:39678442-39678464 CCGATGAAAGCCTTTTTTTTTTT No data
Right 1189260946 X:39678492-39678514 CAGTGGGGACATTTATCACCCGG No data
1189260941_1189260946 17 Left 1189260941 X:39678452-39678474 CCTTTTTTTTTTTTCTTTTAAAG No data
Right 1189260946 X:39678492-39678514 CAGTGGGGACATTTATCACCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189260946 Original CRISPR CAGTGGGGACATTTATCACC CGG Intergenic
No off target data available for this crispr