ID: 1189265888

View in Genome Browser
Species Human (GRCh38)
Location X:39715876-39715898
Sequence TCCCAGTGGGAGGTGGGTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189265880_1189265888 21 Left 1189265880 X:39715832-39715854 CCTGAGATGGAAATTCACGTGCG No data
Right 1189265888 X:39715876-39715898 TCCCAGTGGGAGGTGGGTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189265888 Original CRISPR TCCCAGTGGGAGGTGGGTAA AGG Intergenic
No off target data available for this crispr