ID: 1189266630

View in Genome Browser
Species Human (GRCh38)
Location X:39721724-39721746
Sequence AAGTGTGGCATGCGTTTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189266630_1189266640 21 Left 1189266630 X:39721724-39721746 CCTTCCAAACGCATGCCACACTT No data
Right 1189266640 X:39721768-39721790 CTCTGCCTGGATCATTTGCGAGG No data
1189266630_1189266636 8 Left 1189266630 X:39721724-39721746 CCTTCCAAACGCATGCCACACTT No data
Right 1189266636 X:39721755-39721777 GGACTGCCCTTGCCTCTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189266630 Original CRISPR AAGTGTGGCATGCGTTTGGA AGG (reversed) Intergenic
No off target data available for this crispr