ID: 1189267075

View in Genome Browser
Species Human (GRCh38)
Location X:39725314-39725336
Sequence ACCCAAAGGCTGACCTGGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189267064_1189267075 2 Left 1189267064 X:39725289-39725311 CCTTGGCAACCTCCCTATCCTCC No data
Right 1189267075 X:39725314-39725336 ACCCAAAGGCTGACCTGGGCAGG No data
1189267063_1189267075 17 Left 1189267063 X:39725274-39725296 CCTGGAGGAGACACACCTTGGCA No data
Right 1189267075 X:39725314-39725336 ACCCAAAGGCTGACCTGGGCAGG No data
1189267067_1189267075 -10 Left 1189267067 X:39725301-39725323 CCCTATCCTCCCCACCCAAAGGC No data
Right 1189267075 X:39725314-39725336 ACCCAAAGGCTGACCTGGGCAGG No data
1189267065_1189267075 -7 Left 1189267065 X:39725298-39725320 CCTCCCTATCCTCCCCACCCAAA No data
Right 1189267075 X:39725314-39725336 ACCCAAAGGCTGACCTGGGCAGG No data
1189267062_1189267075 18 Left 1189267062 X:39725273-39725295 CCCTGGAGGAGACACACCTTGGC No data
Right 1189267075 X:39725314-39725336 ACCCAAAGGCTGACCTGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189267075 Original CRISPR ACCCAAAGGCTGACCTGGGC AGG Intergenic
No off target data available for this crispr