ID: 1189268039

View in Genome Browser
Species Human (GRCh38)
Location X:39731291-39731313
Sequence TAATTATTCTAGCTTCCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189268039_1189268048 29 Left 1189268039 X:39731291-39731313 CCTGCTGGAAGCTAGAATAATTA No data
Right 1189268048 X:39731343-39731365 TCTGCGGGCGGTGACAGGAGTGG No data
1189268039_1189268047 24 Left 1189268039 X:39731291-39731313 CCTGCTGGAAGCTAGAATAATTA No data
Right 1189268047 X:39731338-39731360 CCTGCTCTGCGGGCGGTGACAGG No data
1189268039_1189268041 13 Left 1189268039 X:39731291-39731313 CCTGCTGGAAGCTAGAATAATTA No data
Right 1189268041 X:39731327-39731349 CTGCCTCTCCTCCTGCTCTGCGG No data
1189268039_1189268040 -10 Left 1189268039 X:39731291-39731313 CCTGCTGGAAGCTAGAATAATTA No data
Right 1189268040 X:39731304-39731326 AGAATAATTAGCACAGCATTTGG No data
1189268039_1189268042 14 Left 1189268039 X:39731291-39731313 CCTGCTGGAAGCTAGAATAATTA No data
Right 1189268042 X:39731328-39731350 TGCCTCTCCTCCTGCTCTGCGGG No data
1189268039_1189268044 17 Left 1189268039 X:39731291-39731313 CCTGCTGGAAGCTAGAATAATTA No data
Right 1189268044 X:39731331-39731353 CTCTCCTCCTGCTCTGCGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189268039 Original CRISPR TAATTATTCTAGCTTCCAGC AGG (reversed) Intergenic
No off target data available for this crispr