ID: 1189268047

View in Genome Browser
Species Human (GRCh38)
Location X:39731338-39731360
Sequence CCTGCTCTGCGGGCGGTGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189268039_1189268047 24 Left 1189268039 X:39731291-39731313 CCTGCTGGAAGCTAGAATAATTA No data
Right 1189268047 X:39731338-39731360 CCTGCTCTGCGGGCGGTGACAGG No data
1189268038_1189268047 25 Left 1189268038 X:39731290-39731312 CCCTGCTGGAAGCTAGAATAATT No data
Right 1189268047 X:39731338-39731360 CCTGCTCTGCGGGCGGTGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189268047 Original CRISPR CCTGCTCTGCGGGCGGTGAC AGG Intergenic
No off target data available for this crispr