ID: 1189273596

View in Genome Browser
Species Human (GRCh38)
Location X:39768960-39768982
Sequence GATTCAGGAGGGCCACATGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189273589_1189273596 10 Left 1189273589 X:39768927-39768949 CCTCACAGAATCCAAAGGAAAGC No data
Right 1189273596 X:39768960-39768982 GATTCAGGAGGGCCACATGAGGG No data
1189273590_1189273596 -1 Left 1189273590 X:39768938-39768960 CCAAAGGAAAGCTGACCAAGCAG No data
Right 1189273596 X:39768960-39768982 GATTCAGGAGGGCCACATGAGGG No data
1189273587_1189273596 28 Left 1189273587 X:39768909-39768931 CCAAAAAGATGCTGGATACCTCA No data
Right 1189273596 X:39768960-39768982 GATTCAGGAGGGCCACATGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189273596 Original CRISPR GATTCAGGAGGGCCACATGA GGG Intergenic
No off target data available for this crispr