ID: 1189273704

View in Genome Browser
Species Human (GRCh38)
Location X:39769726-39769748
Sequence GTTAACTCCCCTACAGCTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189273700_1189273704 11 Left 1189273700 X:39769692-39769714 CCATCAACTCTTTGATGGTCATT No data
Right 1189273704 X:39769726-39769748 GTTAACTCCCCTACAGCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189273704 Original CRISPR GTTAACTCCCCTACAGCTCC AGG Intergenic
No off target data available for this crispr