ID: 1189274989

View in Genome Browser
Species Human (GRCh38)
Location X:39778969-39778991
Sequence TGCCCCCAGCACCCCACGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189274979_1189274989 19 Left 1189274979 X:39778927-39778949 CCCACAATCTCTATCCCATTCCC No data
Right 1189274989 X:39778969-39778991 TGCCCCCAGCACCCCACGAGAGG No data
1189274980_1189274989 18 Left 1189274980 X:39778928-39778950 CCACAATCTCTATCCCATTCCCA No data
Right 1189274989 X:39778969-39778991 TGCCCCCAGCACCCCACGAGAGG No data
1189274985_1189274989 -8 Left 1189274985 X:39778954-39778976 CCACGCCCCATGATCTGCCCCCA No data
Right 1189274989 X:39778969-39778991 TGCCCCCAGCACCCCACGAGAGG No data
1189274981_1189274989 5 Left 1189274981 X:39778941-39778963 CCCATTCCCACTGCCACGCCCCA No data
Right 1189274989 X:39778969-39778991 TGCCCCCAGCACCCCACGAGAGG No data
1189274984_1189274989 -2 Left 1189274984 X:39778948-39778970 CCACTGCCACGCCCCATGATCTG No data
Right 1189274989 X:39778969-39778991 TGCCCCCAGCACCCCACGAGAGG No data
1189274983_1189274989 -1 Left 1189274983 X:39778947-39778969 CCCACTGCCACGCCCCATGATCT No data
Right 1189274989 X:39778969-39778991 TGCCCCCAGCACCCCACGAGAGG No data
1189274982_1189274989 4 Left 1189274982 X:39778942-39778964 CCATTCCCACTGCCACGCCCCAT No data
Right 1189274989 X:39778969-39778991 TGCCCCCAGCACCCCACGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189274989 Original CRISPR TGCCCCCAGCACCCCACGAG AGG Intergenic
No off target data available for this crispr